T7 RNA Polymerase
   HOME

TheInfoList



OR:

T7 RNA Polymerase is an
RNA polymerase In molecular biology, RNA polymerase (abbreviated RNAP or RNApol), or more specifically DNA-directed/dependent RNA polymerase (DdRP), is an enzyme that synthesizes RNA from a DNA template. Using the enzyme helicase, RNAP locally opens th ...
from the T7
bacteriophage A bacteriophage (), also known informally as a ''phage'' (), is a duplodnaviria virus that infects and replicates within bacteria and archaea. The term was derived from "bacteria" and the Greek φαγεῖν ('), meaning "to devour". Bac ...
that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.


Activity

T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa.


Promoter

The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7   TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine.


Structure

T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and transcribes it. The N-terminal domain moves around as the elongation complex forms. The ssRNAP holds a DNA-RNA hybrid of 8bp. A beta-hairpin specificity loop (residues 739-770 in T7) recognizes the promoter; swapping it out for one found in T3 RNAP makes the polymerase recognize T3 promoters instead. Similar to other viral nucleic acid polymerases, including T7 DNA polymerase from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand with three subdomains termed fingers, palm, and thumb. The N-terminal is less conserved. It forms a promoter-binding domain (PBD) with helix bundles in phage ssRNAPs, a feature not found in mitochondrial ssRNAPs.


Related proteins

T7 polymerase is a representative member of the single-subunit DNA-dependent RNAP (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase ( POLRMT), and the chloroplastic ssRNAP. The ssRNAP family is structurally and evolutionarily distinct from the multi-subunit family of RNA polymerases (including bacterial and eukaryotic sub-families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic
rifampicin Rifampicin, also known as rifampin, is an ansamycin antibiotic used to treat several types of bacterial infections, including tuberculosis (TB), ''Mycobacterium avium'' complex, leprosy, and Legionnaires’ disease. It is almost always used t ...
. This family is related to single-subunit
reverse transcriptase A reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. Reverse transcriptases are used by viruses such as HIV and hepatitis B to replicate their genom ...
and
DNA polymerase A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules from nucleoside triphosphates, the molecular precursors of DNA. These enzymes are essential for DNA replication and usually work in groups to crea ...
.


Application

In biotechnology applications, T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into vectors that have two (different) phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can be selectively synthesized from either strand of the insert DNA with the different polymerases. The enzyme is stimulated by
spermidine Spermidine is a polyamine compound () found in ribosomes and living tissues and having various metabolic functions within organisms. It was originally isolated from semen. Function Spermidine is an aliphatic polyamine. Spermidine synthase (SPDS ...
and ''in vitro'' activity is increased by the presence of carrier proteins (such as BSA) Homogeneously labeled single-stranded RNA can be generated with this system. Transcripts can be non-radioactively labeled to high specific activity with certain labeled nucleotides.


See also

* T7 expression system


References


Further reading

* * * * - note that the nuclease activity reported here is an artifact.


External links


T7 RNA Polymerase Enzymology

OpenWetWare
{{polymerases RNA Phage proteins